Arabidopsis_thaliana Locus poly:U31a
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U31a
Arabidopsis_thaliana
poly:U31a
1
U31a, SnoR4a, U33a, U51a, SnoR5a
1001..1103, 1139..1215, 1269..1349, 1399..1484, 1532..1671
2671
TCATCATCCTTAGGAGCTACATTCTCTGTGCTGGAAACACTGCAGCTCAATTTCCTGTT
CTGAGCATACCCGACACTTGAAAAAGACACCTTTCGATTGCTTAAACCTGAGCATATCCA
GTAAGAAACAAGAGATCAGTGGCAAGATTCAGCAATATACCGGAAACAAAGAGAACCACA
CACACAAATTCTAGTGAAATCTCAATAAAACCAAAAGCCAAGAAAAGTAACCAGATTTGG
AGGTTTTGGAGAAATTCAGAGCTCTAGGATGGAGGTGGAGATCAGAGGATATTCCTGAGG
AAAAGAAGAAAGCTTGTTTCATCAACTGATCTTAGAATAAAGCTTACTATTAAGAAAACA
ACACAAGCTCTGAATTTTACAAGACAACCAAGTTTCCTATTAGTACAAGAAGATGACATT
GACAAGCAAAACAATATAATAGAAAAGTGGATCATCACTAAAGCAGGATTGATAGCAGCG
GAATTCACAACTAGAAAACTCTATTTAAGCTCTTTGAGTAAATACATGGAACAAGTTATC
TGCATTTCTATCCCCAGAAAGAAAATAATACCTGTAGACATCTCAATTTGACACTGTTGG
AAATCTCAGATGATATCGGATTTTCTCCCGTCGATGAAATGAGACGAGAGAGGGTCAGCT
GAGTTTTTGTTTTTGTACAACAAATGGTTTTGTACAACAGAGGAAGAGAGACGATCGAAT
TATGGGCCTTTTGGATTTTATTTGGATATAAATTGGGCCTATAATAAACTAGGCCCATAT
ATAAAGCGGTGGGAAGAGAGAAACCCTAAAAACCTAAGGAGTCTTCTGCTTCTATATAAA
GCCTAAACCCTAACCTCCTCTTCATCCAATAAATTATCGACGGCCAAATAAAGTTTTGAT
TTTTATCTCTCATTCGGTAGATTTAGTGAATTAGGTGTTGTTGGTGTCTATGCTTCTTCG
TATAGCTTAGATTTTGTTATTTTCGTAATTCGTTTAATGTTTTTGAGGAAAGTGATGATA
TGAAATTGTCGCCCCAGGCTTAATCTGCATCCATTACGATGGTTGTAACATGGTGATTGA
CTATTTTTGTCTGATTCTCTCAAATCGTTTATTATGATTCTGTTATAATGGTTGTGTATG
GATATGATGAAATGGCAATAATGTTTTGTGACACCCAGTCTGATCTTCGTGATTGATTTG
CCATATTTTCTGATCCTAATTCTTCTTCAGTTTTGTGAATTTTGATTCAAAGTTTTGATC
TTTGAAAGGGAGGAATGAGGATGTAATTCCATACGTCTGCAAATCTGAAATACAGTGTTG
ATACAATGACATGCACTACCATCTGACCTCTGTTTTCTTGTTTTTGTTTTTGTTTTCAAT
ACCCTTTTGTTAGTTGTCTGCAATCAGTGATGAAATTATGTCAAATTCAATGATTATACA
ATGATTATTATAATCACTAGATCACCATCTTTCGGCTGAGATTGCTGTTTCTTCTTTTTT
GGAATTATTGTTTGTGTTATTGTTGACGATTTGCCTATGGTATCTGATGTCCAAAGTTTG
ATAATTGTGTTTGGACATTTCGTTTTTCTTAGGCAGAAAGTGATTTCAGGCTTTGCGACA
CTGTTAGCTTATCACATAAGCTACCTGTTACTTTTAATACCTGGTTACATCTATATATCA
ATCTTTGGTTTGGTTTGGGTTTTAACATCATTGCTCCTTTTGTTTTTCGTATCATCTTGT
GTTTTTATGTGGTCTTGTGCAGGATTTGTTGGCTTGTTCTCTTGGTGTAGGATTGGCTTC
TAATGCGGATGATATGCTTACTACGAGCAACTTCAATCGGTCTCAAGAATCAAAATTGTC
TGTTGTTTAATGTTGTATTTGATGGACGAATCTAGTCTTCTAAGACTATGTAATGTAATC
TCTTAACCCAATAAAGAAAATTATCAACTTAGCAATATTCATTGTCTAACTTATTTTCAT
AAAATGGCAAAGATACTGAAGTTGATTTCCAGATGATGAGACACTCTAAAAGAGAGACAA
ACATGATATCTTGTATTTCTGTAATGATCTGACTAATCTAATAATACAGTAGAATCATTA
CAAACAAAGAAGAAATGGCTTGATTTTGATTCTCTAAAATACAAGCCGAGTACTACTATG
TTCTTGAAGTTGAAAAGAGCATGGTAAAGAACATCTAGTACTAGAGATTGACGTTATAAG
AGCCTTTTCTGTGTCTCCATCCATTCGTCTTTGGACCAATCTGATGAGATACTCCAAGAA
AACCGAATCGAATGGCAATGTGATTGGTCCTTCCGTGGGGATGCCAAACTCTTCTTCGGA
TATCTTCAAGAGCTCTTGGATAACAGAGTTGCTCAGATAACTTATTGGAAAAGCAAAGCG
GATTCTATCGGATGTGTAAACCACAAAACAGCCCTTCTCTGCAGCGGTTGAGCTGCTAGT
AGTATCAGTTGATCTATGAAAAGAGATTCTTTTCCTTCTTAAGGCAGCTCTCTGTTGCCA
TTTCTTGGCCATCTTCAAGAGCTTCTTTGTGTTCATCATTATATTTAGGGAAAAGCTGTT
TAAGATTGGAAAGAGGAAGAGATGTGCAAATTGTGTTGTATAACGTAACTCTTTGAATGC
AAGTTGTGGTTGATGAAGAATCCAATAGGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
CP002684 NC_003070
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved