Arabidopsis_thaliana Locus Mono:U35
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:U35
Arabidopsis_thaliana
Mono:U35
U35
1001..1089
2089
AGAACAGCACGAGGAACGTATCTTCCACCTGAAGCTTCATTGTAATAGACATTGATACG
TTCAAGCTGGAGATCTGCAGTGTCTCCACTGTAACGTCCGGTGGAATCGATGCCGTGCTC
GTCGCAGATGACTTCCCAGAACTTGGAACCAATCTGGTTACCGCATTGACCACCTTGAAT
GTGAAGGATCTCTCTCATTGTGTTAGTGTGTGTAGTGGTTCACAAGATCGAGAGAGAGAG
AGATGGTGAAGGAATATGAAAGATGGGAGTGACAGCTAATATAACCAATTGTCTCTGTTA
TTCATCACTTCCCTCGCTTGCGAGGTTTTTATTCTCTGTTTTTTTTCACCCCACCTAACA
CTTTTTTATCTTAGTCATTTTACATTGTCTTATTCACTCAAAATTTACCGCCGAAAGGTT
TTTAGATTGGCATAATTTCAGATTTCAGATTCAGTGTTTAATTAGCAACTTGGAGCATGC
ATGTGCATATATTGCCAATGTATGTTGTTGACATGTTGTATACACATGAATATGTCTATA
CAAAAACAAGCTTTATAATATATTTTTTCCCAGTTGTAGAGTAGAGATATGGGAGCACGT
TATGCAAAATTGTATTATTGAAAAAATTGTATTTTTTTCATTAATGTAGTTAAATTGTTT
TCATATAATAAATTGTGTGTTAAAAATAAGGAAGAAGAAAGTAATCTATACAAAAATTTA
TAACTTTCAATTTCAGAACTAGATCTAGTAAAGTCATACATGGGCCAGACATGTAGATAA
ATAGACGAGCCCATTTAAAAATAAACGGTGTCGTATGCTTTAATTGTCAAACTAAACCCT
AGATTTGCTCCATCATCCTATATAAAAAGGCAAACTAGTCTTCAGTACCCATAATCGCCG
GCTATATTCGTCTCTTTTTTCTTCGTGTTTTTGTAGCTTTCATCTTTGATATTGTTTTAC
TTTGCTAAAGTAATCGATTTTTTGATGTGAAGAAGTTAAATTCAAGTGATGAGATTTGAT
CTAAAATTCTCACGACGGTCGTCTGAGGCCTTTTGTGGCCGATTGATGTACCGATCACTC
CTCTCTGATGATAAACTTTCTTCTTTCCCAAATCTCCTTTGTTTTTGTTTTAATCCAAAC
TCTTGTTGATTTGTAGTTAATCTAGTTCGTTTTTCATATTGAGAAAAGAGATTTATGGAA
TTGGTTGTGTTATACTACTTTATAGTATATCTGTATATGGTTTGACGACCTTGTGGAGAT
GACCGAAACAATAAAGTAAATACATTGACCAATTGAGAAACTGTTATGCACTGAAACTTC
TAACTACCAATGATCTCTTAATCAAGATTGTGAATTACTTGGATTAGTCTCCCTGAATTA
GACTTCGATTATTGCGTAGTAATTATCTTAATCCCATATGCATATATGGTACATAGTTTA
AGGATTTTAAAGAGAAACAATTTAGTAATTCATGTAAACTTTGAGCTTTCTGTTTTATTC
GACACAATCAAGGGGTACACACAAGTTTTTTCTATGCTACTAGACACAGTCATCTGCGTG
GCACACATGTTAGATGGGCAGTCCATGAGCAATACAGACAAGCACTCATGACAAAGATTG
TTGAACCAACGACGGCTAAGCTTGAACGTAGAGACATATAACTATGTAAGTGGAGCAAGG
GAACAGCCACCAAGAGATTGTTAGCTCTTAGCTGTACTAGGACCTGATGTTTTCCGGTCG
AGAACATACCAGCTGAGTTTAGCTGGGAGGTTCAACATGAAAACATAGATATAGCATTCG
GGACAGTCTAAAAGGGACCGTCTCGCGTATAGTTCAGGTGATGCAACCGATAGACGAAAC
ATCTTGGAAACAAGAGAGAGCGTTGGATAGTACCAACTCTCTTGGAAGTGACATCATCTC
CATATGTAAACTAGATTCCCTAAAACAAAACAATCCACAACTTCAATTTTGTATATACAT
TCATCATTTTGCAAATGTGGATATATAGGCATTGATTGAAAAGTGAAATGGTAAAATATG
ATATAATTTTGATCAGGTAGGAAAGTTATGGGTGATAATATCTTGTCCAA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003070.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved