Arabidopsis_thaliana Locus poly:SnoR16-1
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:SnoR16-1
Arabidopsis_thaliana
poly:SnoR16-1
SnoR16-2, U43-2
1001..1083, 1126..1211
2349
CCATATAGGAAAGAACATTTATAAAAGTCATGATGCCATATGAATTTGTGTAGTAAACA
TGGAATATATTGAGCTTTTTGTGGATATATTTATATGAAAATATAACTTCTGGAATGATT
CTTTTATCTATCCACGAGAGATGTTGGGAACGAAAGCTGCTGCCCATTTATATAGGATAA
TGTTTTTTCCCTCTCCGACTTTTGCATATAGGGCATTATGGCTTATCTGAGTAATACGAG
AACAACAAGTTAGCAACACCATCGGTCAATTATTTAGCTACTACACTATTTACACCGGTA
AAAGGATGTTGTTTTTGTGGTATAGTAGAGTCTTTATAGGTATAGTCACTATGAATGTTG
CAGTCGTCTAGTTGTTTTACCGCACTGATTGAGATAAATCGATCGATTATTGTTGTACAC
ATACGTCAATCAGGAGAGATTCAAATGTTTAATGGGTGACAAGTCTATACTTGTCCCATG
AAATCCAATTACCAAAGATTGATAGTCCAAAAAGTACTAAACAAAACCCAAAAGGTCGAT
GATATACACTTGATGGTTTTAGTAATCGAATATTCGTGCTCAGTCCAGACCGAACCTTTT
ACATATGGACGACGATTCTCTATGGATTTGTTTTAGCCACATGCTTATAACAATATTCGC
ACATTTGAGGGTTTGAGCCAATGTTGGGTCAAACATGTTGGGCTCTTTAAACTCCTTATC
TGCCCAAACATGTTGGGCTGAACCTTTTCTGAGTAACTCTAGCCCGTTAGGTCATTATAA
TTATAGAAAAATAAAAAGCAAGGCCACTATAAACTAAACCCTAGTCCGTCATCTCTTCGC
TATATAAACTCTTTAGACAATCCAGCATCCAAAACCTCCTAGATCGCTCATAGTTCTCCT
AGATCGCTCATAGTTCTTTCATCAATTTGTTCGGAAGTGATTGCTTTATGTTTATCATTG
TTTTGTACTTGATAGATTTTAAGAAATTAGGGGTTTATGATTGGCAAATGATGAGTAGAA
TCTTATCCTACACACAGATGTATCAGTGTTGACTACCAATCTCTGCTTATTATCTGATGC
CATATTCTAAACCCTGTTTTCAAAAGTTTTTACAGTTAATCCGTTCGTTTTCAATTTTGT
TCCAGCGTTTTTTTTTAAAAAGGATCTTCTGGGTAAATGTTGGTTTTTAAAATAAGTTCT
TAATTGTAATTCTCTTTTTATTCCTGTGAAAATGAGAAGAAAATTAGAACAACCTAATGA
AGAAACAATGATGAGATACTTGCAGACGGGCGGTCTGAAATTGATGTCGTGTTGATTGTC
TGCCATAAGCTACATAAGCATTCTCTGAGTTTCTCATTCACTCGTGAACACATCTGTTAT
GTCTTAAACTGTTGAGATTGTAATGAACCAGTGAATTAGTTAACTATACAAAGAGTAGAC
ACATACATCTTTGGACAGGTGTAACCTCTTTTAATATGAAGAACGGCTACATTGAAAAGG
ATGAACTGAAGTAACCGTAAGCCAAAACATCCAATGATAATAAGACTTTTGTTCTGGTTA
TTAATTAGTCTTATAATCAATAATTCTACAGTTCTTTAATTTTCGTTTCCAAGTTCCAAA
GTTTTAAATCATTAGACTTTGGTCAGACTATAAAACGTGTTCAAGGCTTGTGTTTGTCTT
TTATATAAACGTAAAGACTGTTTGGACATGAAGACTTATTTATCCACCGTCTGGATTATC
TACACACCTAAAAAAATGATAGCAATCGCAGCCATAATAAGAGAGAACGCGTTAGTAAAA
GTCAACACGAAGTCAACTCCTTTGTGGCTTTTAGCCCATCCCACTTGGCGCTATTTAAGT
AAAATCCCAGTATTACCAACTTCAAAAAAGTCTCTCTTTCACATTGATCCTGTGTTTTAT
AAAACCGAATTTTGATTCAGAGATCAGCTCAAAAATGAAGTTTGATGAATCGAAAACGCT
CTTACCGGTGAGAAAACCTGTAAATGGCAACCGCAAAACCGCTGGTTACAAGCTTTGGGT
TCTAATCGCTGTTCTACTCTTGGCCTTTGGTTCTATGTTAACCGGTTCCGTCTCTCTCAA
AGGAATCGGTTTGTTCCATTCTGCTGACGGCGTTAACGCATTCTCTTTCGGCGATGATCT
CGACGTTCTGGTACGAATTTATTCATAAATTATTATTGATTTTTGTTTTCTTCCAAAATT
GGTCTTTCAAAATTTTGAGAAATTTTAAAAATTCTGACAGGAAATTGAAGAGAGAGAGAA
AGTGGTGAGACAGATGTGGGATGTGTACGGACGCTCCGGTGGCGTTAAGGTTCCTCGGTT
CTGGCGAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved