Arabidopsis_thaliana Locus poly:SnoR44-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:SnoR44-2
Arabidopsis_thaliana
poly:SnoR44-2
1
SnoR44-2, SnoR17
1001..1093, 1165..1274
2274
CATCCTTACCTCAATAGTTTGATTCCTTCAGGATAACAAATTAAGGACCACAGTTCAAG
TGTTTTCCAAACGGGACAAATAGTTTACTGAATTTAAGGTTACATAGATAGAACTCATGT
ATCAAGTACCTTGCACCTAAGAAGAACTCATTTATATTAACATCACGATCCATTTTCATA
AAAGTCTTCTTGAGGGCCTATGGCCCTATACAATAAGTAAATGTTTCAGCTCAATATGTT
TCCCAAAACCAATAATATTATGAGAAAGGAAGAGAGTTACCTCAAGGCTCTCAAGTTTTC
GGCTAAGTTCAAAACAAAAAGATATAAGTTTTATAACATAAGTACATGACTTCATATGTA
CTTGAGATTTGAGGAAAAATGTATGCTCAAACGATACAACAGCTTAAAAATAAACTTCTC
AAGATTCAAGAATGACAGAGTCTCTTAGACAAGAGAGAAACCACTGTAAAGGAAGAAAAC
AGAGAATGTTCTTTTATTGGGCCTTTAATCAACTAGGCAGTTTCGTTTAATTAATTATCC
AAACGAATGGTCTTTTTTATTTTATTGGGCCTTTTTGATTTATCTAATGGGCTATTCATA
TTTACCTACGAGCCCAGTCATATCTTTTCAGTTCCTTATTTTTGCCCTAATTTTCGCCGC
CTCTGCTTATCTTATATAAAGCCATCGCGTTTCATTAAAGCTCCAATGGGAGCCACTTCT
CTTGAAACCCTAGTCTTGTATCTCTGTAAATTGTCTCATCGATTCGAGGGCTTTCCAAAG
ATTCAGTCTTTTGTCTGTGTCGTGGTTATTTCTGTTTAATTGTATGTTTGTTTTGATGCC
TGTGATGGTATTAAATATACTTTGAGAGCTTTGTCTCTAGGAAAACAAAACAAATCTGAG
GCATTTAGAATCTTCTTTTTTTCTTTGGTTATGAAATCCAGTTTGAAGTTTGGATGTGAA
TAGGTTTATTTTTTCTAGTTTTTATTACAAGTTTAGTGTGTGTGCAAGTGATGATAAAAA
GACAGGGACATCAGATTCTCCTTTGGGAGAAGTATAATGATGATTAAGTCTAGATGGGAA
TCTCTCTGATGCACCTTTTAAATTGTTAATGATGTTTGTTTTGTGCCGGTGATGTATATC
TATTGATGTGTTTTCATCAGATTTTCATAGTGATGAATTATATCACAATTGTCACTACCT
CTGAGGCATATTCTTGATTCGTTTTTTTTTTTTAGATTTTGGTTTCTATCACCTTACTTC
TTTAGGAGCCTGATGATTGCATCTAAGAACGGAGATATGAAGGGTTGTTTTGTTGTAGCC
TATATTTTGTTTTGGGCTCCAAAGCTTACCCAATGTAATCATCTTGCTTGACTATATATG
AAGGCCTCGATATCATGATCTTGTATCACATCTGGACTTTCGTTCTCAATTCTTTTTTTT
GCAGGAGGGCGTGTCCATAGAAGGGTTACAAGCTCTCAAGATTGCTCCAAGTTTTTGTGA
CAATTGTAACTTCATAATATAGCGTTCATAACATGTAACTGATTGTATATCTTTTTTAAT
TCATGATGCCTTTTCTATTCTAATTGTGTTTCTTCTTTAAGAAACGTCGACTATAATCAA
AAACAGACAATTTATCTAATCGATCAGAAAGAAATATCTTTAAATTGTAATGCAAGTTCC
GATCCGTATAAAATGGAACCTTATTCATAATTAACAATCTTTGATGAGAAAATTATACAT
AAACAACAAAGATTGGAAAAATGGAGTGGTTTGTATCTCCTGTCTTTTATATTAACAACC
TTTAACCAAAATGTTCTCTCGTTCTCTAGCAATTTGTCTCCATGATCTTCACGTTCACCA
GACAAACAAACCCACAATTTGATAAACATACTTCAACTCTCCAGAATATTAAACAGATGA
TGATGTTCCATTGAATTTTCGATAAACATCATTCAGAACCATGATGCTTTCCAACAGTAT
CAAGACCTTCTGTTCTGCTTCTTACAATCCGATGAAACACTTCCCTCACTTTCCTCTCAA
ACGGATCCAAACCATTCTTCAAAGCCTCTTGAAGCTTCCCCAATTCCTCAACTCTCTCTC
TCACTTCCATCTCTTTCTCTTCAGACAAAGGAAACTGAACAGAATCAACCAACTCATTCA
TCAATCTTGAAGTCTTCTCAAACTGATGAATCTCTTTCAACAACCCACATGTATTCTTCC
TCTCTCTCTTCTTCGATTCCTCAATGATCCTATCGTGCAACGACATCAACGAACC
  Untranslated Region
  Coding Sequence
  snoRNA
CP002684 NC_003070
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved