Arabidopsis_thaliana Locus poly:SnoR44-1a
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:SnoR44-1a
Arabidopsis_thaliana
poly:SnoR44-1a
1
SnoR44-1a, SnoR44-1b
1001..1097, 1178..1259
2259
GAATACTCACTTCAATCACCTGATAAAATTCTACTTATTGGAAGGAATTGATTGTATAT
TTCTCCCTATTGAGAAAATGATGAAACTTGTTTTAAAAGAAGAAGAAGAGCACCAATCTT
TGAAGATGGGGGACGTCTAAATTCGGACACAGAGTCTATCTCTAGACAACAAAATTCACT
GTAACGGAAGATGTTTTTTTTTTAAAAAGGGGTCTTTCGCAGCAGAAACAGAGGAAACAA
AAATGGGTGTTTGCGTCGAAACAAGAGAAGAATTCATGAAAATGAGCACAGAGGAGGCGA
AAGTCACAAAGAAGAGAAAGATCATGGAGGAGGAAAGAAAGAAAAAAAGGCACCAAAAAG
ATTTGTCCCGAGGAAGAAGAAGGAGGAAGAAAAGTTTGAATAAGAGAAAAAGGGGAAAGA
TTAATGGTGGAACAGAGAGAAAGCTCACAGAAGCAGACGAAGGGACAACCTTTTATTTCG
CTGGGAAACTTAAGACGTCGACCAACGGAATTGTGTGCTTCTGTGCTAGAGAGAGACAAA
GGTTTAACCAAACCGGTTTTGTTAATTCAATTGCCTTAAAAACCGACAAAACCAAACCGT
TTTTTGTTAATTGATTAACATGTGTATTCGTTGGGCCAAAGTAGAAAGCCCATTAATATC
TTTGACTTGTCTCTGCCCTAATTAGCTCCGCCTCTCTTCTTAAATACGTCTATTTATCAC
TTCTTGATAAACCCTAGAATTGACCCATGTTAATGTTTTGAGATTTGATCTTTTTGCAAG
TTTTTTGGTTGTTTTTGTTATGTATATTTTGATTTTGATGCCTGTGATGGTGTTAAATAT
ACTTTGAGAGATGCGTCTCTACGAAAAAAAAATCAACTCTGAGGCATTTTTTCTCTCTCT
TTACACATCTGGTTTCTCTTATTTTACTGTGATCTTTGAGCTTATTAATGATTTGGTTTT
GGTAGCTCTTCTAGCTTCTGATTTGATTTGGTTGCCTGATTTATGCAAGTGATGATGAAA
AGACAGGGACATCAGAATCTCCTTGTTAGGAGATGAGAATGATGACTAATGTCTAGATGG
GAATCTCTCTGATGCATATCTCACAGACTGTTTATCAACTTTGATCTAGTATTTTCTGTT
TTGCTTCGTTTTGATACTCTTTTGGTGTCTTTTGACTAGTGCAAGTGACGATGAATAGAC
AGGGACATCAGAAGTTCTATAATGATGACTAATGTCTAGATGGGAATCTCTCTGATGCAC
ATAACTAAGAATCCTTTGCTCATTATTTAACATTTTTTTGCTTGGGTATTTAGTTGGTTT
TGCCAATGATGTGCCTAAACAATTGCACGTATTATCAGATTTTTCAGTGATGAATATCAC
TTATGTCTGAGGCAAACCGTGAATACTGTCTACAACAAATGTTTGTTCTGTTCTAATCCC
TAATCATTTATTTGGATTTCATTTGAGCTCTATTTGCAGGAAGAATCACTTGCAAGAAAT
AAAGTAGGACGTCACAAACATGAAGCTGGACTCAAGCCAGCAGAAGATTGTGAAGATTAG
ATGAGAAATTTAAGGTTATGTCTAGATTTTGTATGTGCTTCATTTGAATTGTAAAACAGA
CCCTTTAGTTGAACCTCTTCTCTAAATAAAGATTCATTTGTTTCTTGAATGTAATCTTTC
AAATTCAATGAAGTATTTGATACAACTGTTCATTGAAAAAATAACTTCAATCTAAGCAAG
TAGCTACACAAAGAAGAACAGAATCACTATCAGCATCACAAAGAGAAGATGACACTTCTA
CACTCTTTGAGTTTCTTTTTTACAAGTGATCAAAAAGGATAAATAGAGAAAAACAAAAAC
AAAACAAAAAATCCAAACATGAATCATTCATCATATTCAGACAAACATGTGCAAGATCAA
AGAGAATCAAGACTCTCAGTTCTGCTTCTCACAATCCGATGGAAAACTTCTCTTACTTTC
CTCTCAAACGGATCCAAACCATTTCTCAAAGCTTCACGAACTTGAACAAGCTCATCAACT
CTCTGTTTCACCTCAACTTCCTTGTCATCATTCAACGGGAAATGAATCGAATCGATCAAT
TCATTCATCAACCTCGAACTCTTCTCAATCCTATCAATCTCCTTAAGCAAACCACAACAA
TTCTTCCTATCTCTTCTCTTAGATTCCTCAACAATCTTATCGTGCAACGACATAACCGGA
GCTGCCCATTGGAAATGCCTAGGCACAAAGAAGTTAACTT
  Untranslated Region
  Coding Sequence
  snoRNA
CP002684 NC_003070
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved