Arabidopsis_thaliana Locus AT1G07705
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana AT1G07705
Arabidopsis_thaliana
AT1G07705
SnoR35
4762..4842
6478
AAACCGCACTTGACACAGCAGAGAAAATTGGAAATCCAGAAGTGGCTCTTATTTTACAG
AAACATGGTGTTCCCAGCGCCAAGACCATTAAGCCATCCGGGCCTAACCCCGCTCGGGAA
CTGAAACAAACCGTAAGCGATATCAAGCATGAGGTTCACAATCAGCTTGAGCACACACGC
CTGACCAGAAAACGTGTTCAAGGAATCGCCAAACAGCTTAACAAAATGCACACTGAAGGT
CTTAACAATGCAATCAACTCGACTACTGTTGTAGCTGTTCTTATTGCCACGGTCGCTTTT
GCAGCAATTTTCACTGTCCCGGGGCAGTATGTAGAAGACACAAGTAAAATTCCAGATGGG
CATTCCCTCGGGGAGGCGAATATTGCATCGACGACTCCGTTCATAATTTTCTTCATCTTT
GATTCGATCGCACTCTTCATCTCCTTAGCGGTCGTGGTGGTTCAGACATCAGTGGTGGTA
ATAGAGAGCAAGGCCAAGAAACAGATGATGGCTGTGATAAACAAACTCATGTGGCTTGCC
TGTGTTCTCATCTCTGTTGCCTTTTTGGCTTTGTCGTTTGTTGTTGTTGGTGAAGAAGAG
AAGTGGCTAGCCATTTGGGTGACTGCTATCGGGGCAACTATAATGATTACGACGTTAGGG
ACGATGTGCTACTGGATAATACAGCACAAGATCGAAGCTGCCAATTTAAGAAACATTAGA
AGATCCTCCATCAACAGTATATCTGGATCCTGGGGGATTCCCCAGCTTACGGATTCTGAT
ATTCTCCAGAACGAGTGTAAGAAAATGTATGCAATCTGACTTGACGATACTCAATCCGTT
TTCACATTTATGTACACGGCAAGAACTTGATGTACCTTTTTCTGATACGGTTGATTCAAT
GAGTTGATGCGGGTGAAGCACTGGTATGGAGGAGTTACCTGAGATGCTTCGAACAGGAGA
AATCGAATAAGGATTAGAGCAGAAAGGAAGAGAGTAACATTAATGTAACACCGATTCTAA
ATGGGGGAAGAAATGTGCATTGGTTTAACCTATAGCATGAAGAATTTCAGCTATATATGA
TCAACAACAAAAGTTACCAGGAGTTAAATAAACCAAAAAGCTAAATTCCGAGAAAAATAC
ATGTTGGATACTGGTTCCTGTTCTATGAATTTCCTAACCAATGGATACTTTGGTAGGAAA
GTTACATTATAAATACTGAAGAAGGCATAGTTTACACTCAATGTTGAGAATCTTGAGAAA
TGGATGGTCTTTTTTCCAGCATCTCGTAATAGAGAACAAAATTTTCCTGCAAAGAAATGA
TTTTGGGGTATTCTTCAGAGGCCAAATGAAGAAAGATACGATGAGCAGAATTTGGATGTA
CTCACCTTTTGAACGATCTCAAATGAGTTTGGATCAAAACAGTGATATGATCCTCTTTCA
TACGCATTTGTTTTCACGAGAGGTTCCCCGATTCTAATGAACCACAACCTGTGTTCTTTG
TGGTAGAACCAACCCCTATTGTAACTGCAAAACAATAAGAGTTATGCAGCTTTATCCTTC
AGTGCATTGCAATCTGATACCAAACCAGGAAATTAAGACAGAAACCCATTTTCAAGTCAT
GGAGAAGAAAGATGGAATCAAAAGTTGATGTTTTGCTTTCATATTCCCTTTCTTTTTCAA
ATGTGAAGACAAATTCATCTTCAATCTATATTCCAAGTTTAATATATGACAACTGTGAAC
AAAAAACTCCGAAGAAGCATTTTCATATTTACAATACTAGAGAAACAAAAATATATTATG
ATGAAAAGGACTTACAGTTCATTAGCCGCATAGAGTTGCGCCTCATCTTTCGGCATGCTG
CACGACAAAAATTGTTATGGTTCCTTTGACAAGAGAGTGAATCAACAAGTACTTTCAATT
CCAAAGACATATACCTATAGAATACGTAAAACAATGTTTCTACCAATAATTTTGCAAAGA
GCCCTTGCTGCATCCACCAAAAAAAAATTAAAAGTTAAAAACAGCTAATGAAAAGAAAAC
ACAAACCCAGATGGACAAATGAATGATGGTACTGATGAGAGACTAGAGTAAATTACATGT
AGAGGTGGAGGGTTTTTTGCGTAGTAACACTGCGGTACACTGAATTCTGGATCAACTTTA
GAGGGTTCATTGGACCAAGGCGAGCCAAAAGTCTTATGAAGATTTTCTGTTGAGTTCAAA
TTTAACCCCAGTGTTGTCAGATCAATACCAAGTGCCAAAGAAGTCAAGTCAGGGTCGCTC
ATCTTTATCACACTGAGCAAACCGAGTAAGCCAAACCGATCAGGATTTGACTGTGTCGAT
TGCATTGATTTTAATCCTACATCTCTGAAAGGTTGGCTAGCAGCTGACATCTGCTGCAAG
CGATACTGGGCTGAGTTCTGTTGGTGCTGATATTGCTGGATGAGCTGCTGGTCATAACCC
ATCCCAGTGATAGAATTTGCAGAATTCATAGATCTTAATCCAATACCCGGAGCTCCACCA
GTCTGAAACCAATCAAATATACCTTAGAAAGAACAAGAACGTTGGTTTCATGAAATAAAA
CCTTAAATGATCTCCGCCTGTTTTAAAATATTACAGACTACATCATACCTGTGAGTGGTA
AGGCGGATGCGAAGATGAGAAGATGTCAGACCCATGTAAGGAAACACCACTACTACTCAC
AGCTTGAGCATGTTGTTGCTGTTGTTGAGGACGGTGTGATGTATATGCTCCACCTAAGTT
AAACCCACCAGACCTTCCCATCTGCAAGGAGCCGCACTAGAGGATAAGGTAAATGTTTTG
AGGAAAACTTTCAATGGAAGAGAATTAAACCCAATGACATTTTTTGACAAGCTACTCACA
GATAATTGTTGAGATTGCATCATTAAAACTGAGTTCTCATGGAGTTGTTCTTTATGATGC
AAATCCATTGGATAATCAGCACTACTACCTGTATAAAACCGATCAATCTTGTCATGACTG
ATGACTATACCTTAATCTAAAATCTATTTATACGAACAACAAATAATTTGAATGCAGACA
CCATGAACGTGTTGGAAAATTTAATAGACAGACTCTGTACTAGTATTATGATGAGATATT
AAGAGAGTAATGTCACATTGGATCATGCAGATCATTAGTAATTCAGCTGGGTGTGATTAC
AAAATCACTCTCAAATCTCTCAACACCAAATATTATGCGAATGTGGAAGGTAGATGGTTC
CTTTTGGGGTATGAATGTCAAATTCCATAATGCACACAAATATGACCCAAATTGAGACAA
TTTCTATCCAGTTGGACCATTTTAAAAAAGTTGCAGATCAGAAGGGTGACCTTTGTATCC
TGGCAATGCTGGAAAATCTTCATTTTGGATGCTGAACTCTTGGTTTTGCTGAACTATAGG
GCTGATTCCAAGGCCTTGTTTCAATCGAGACCCTAAGAAGTTTCAGAAAACAGCGGAGTA
TAGTTTTGCTTCAAACCAATAAAAGAAAGAAGATAGAATTAAAGGGTTTTTCTTACTTAC
CCAATTGTCCTTGACTGCCCGCAGAGCTGGGGCGGCTTGTGAGCTGAGGAAAATCATTAT
TAATATCAAACGGAGAAGTGTCGTTGGAGTTCATATCATTCAGCAAACCCATAGAGCTTA
GACTGTTCATTGCTTGAACATGATTTTGGGAAAGTCCTCCAGCTGAAGGGTAAGAATTTC
CCAGCATCGAAAGAACCTGCGGAGATCCTGAAGAGAAAGGAAAGAATATAAGAGTGTAAA
GATATCATAAACGATGTGACGAAACGAGAAATTTGGGGAAAACATGAGGCCATTTGGTTA
CTGGAGTTCGACTGATTAGGAAATTCAAACAAAATCATGAGTTATTCGATTAATGATTTC
TAAATACTAGTAGAAATCCGGTGTTGTTCATTTAATGATAAAGGATTTAACATCAATACT
AACGGAATTGTAAATCAACTAAAACCATACAAATGCATAACCTATTTCAACAAAGAGCAG
AAAAGGATATAAATCATGAAGTACCTTGTGGCAAGACCCCACCCATCATGCGATTTTGTC
CAATATTTCCGGATCCGCTATTTACTGCCAAATTTAGCCGCGAACCAAGACTCGGAATCG
ACAATCCTCCACCAGAGCTCAAAGTCCTACCCATTGTGCCTCCACCAACCATATTCCCCA
TAGAACTCGTCATTCGAGAACCTACATTTCCCAATATTGGAGAAACTCCCAATCCTGGAA
CAGTAAACCAATTACCAATGGTGGTAGAGGTAGGAAGAGTTCAGGAATGGAACCACCCTA
TTAGTGTAACTACTGAATTAAGGTTTTCCAACAGTATTTATACCTCCCCTATTAGTGAGT
CCTGAGTGTCCATGGGAGCTACCATGAGACATCTGCAAATAAGAATCCAAAAGAAAACTT
TTAAGCAGAGCCAAAGCAAGGGTTCATATTTGCATTATTTTTAGGATACCAACACATAAG
CATAACTGCACCTGAGAGAGTGCAACCGGAATATTGCTGGATGCAAATCTTCCATTCGAA
ATACTTCCATTTTGTTGTTGGACACCAGCAGATGGAACACCATTTAGACTTGAATTTCTC
GATCCAAGACTTCCCGCCAAGTTGGGAACATTAAAGTTTCCATGAATATTATGAAGGCCC
TGAATAGATCCTATAAAAAGAAAAAAACCAATATAAGTTCAGAAGAATTACGAAAGAAAT
AGCGCCGGAGACGTCTACCCACCAGCATGATGAAAAACTGGAGACGCTGCCCCAGACTGA
CCGGAGAAAGAAGAAGTAAACGTCCTCCCTGAACCGTCTGACAAATTCGAGGTAGACCCG
TTTATTGAGGACTGAGGATATCATTGAAATAACCACAAGTCAGAACGACTGATAAACATT
ATTTATCCTAGAAGCTACATTGACAATACTGCAACACACTGATATAAAGATATGTGGAAG
AAGTACATTAAGTAAACTTGACATTTGCAGAGATTAATCAACTCCAGAAGCAAAAGTTCA
TAAGCAAACCAAGCAGGAACCCTTCAGTGAGCTCAGGAATGTGAGATTGCAGTCGTGACC
TGAAAAGAAGGATTATATGGTGAGACAGTAAATACATGGAAAGGAACAAACTTTGGATTC
ATCACAGAACTATAAACAGTAAAACTTCAACGTATCTGAATCATACATTACAAACAATCA
AAACCCTTTCAACAACCGATCAAGGGTTCAAGAGAAAGTTTAACCATTGCGAAATCGGAA
AATAAACAAAAACCCTAAAGCACTCAGATTTATAATCAGCAGTCAAACGAAATTAGAACC
TGATAAGAATATGGACCCAAAGGATGAACAAAGAAACTCAATCTCGAAGCTCCAAGGAAC
GAAATTCTCGAAGATGGAGAAGAAATCGGAATAAAAAAATCTGATCTTTTTGTACTACTG
ACCGTTTTTAGTCTTATGTGTTTAGGACCCCGTCCTCGGAGGCGAACAAATTAAAGGGAC
CTTTTTTTTCTCTACATAGTAATTTTATTTACTTTCAGGGTTTACTAGTAATTAACCATG
TTATTAAGGTAAATTATCAATAATTATAGTGACTAATAAAATTAGGTTGACTATATCCGA
ATGAGATAGTTTCTTAATTGATCATCATACCATATGAGACAAGTTGCAATCTGGTTTAAA
GATCTTGCGGGGACCAAAAATACTTATCAAGTAACCAAAACTAGTAAGCTGTCACTGCAG
ATTTTGCACATATATACTATAAGTATGTGGGTTATGAAGACATAAAGGCAAACAAACAAA
AGAAAGAGATCAAAATGTTGCATCTGTCTTATTCAGTATGACATCTTACAAGAAGAAGGA
TGATGCTGTGTTGTTCAATATAAGTTACATCATATTCAATGATTTGGGAAAGGTAACCCA
AAGAGTGCGGTTTTGTCGAATGTTCTTCAAGATTCCGAGGATGTATATTTGAGAATAGCT
GCGTCGATCCTCTCCTTGTCTCTAGTTGCAAATGATTCTAAGAGAACTCCGTTTTTGTAG
AAGTGGAAGAGAGGAACCGCCTGTAAGATTGTAGTATATCAAACTCTTTACTACGCTGTT
CAGTTAATTTTTGAGTGTTGTTAGTACCAAAATTCTAAAGAGGGATTACCTTGATACGGA
GCCTTTCTGCGACTTCAGATTGTTCATCATATTCATCTACCACCTGCAAATAGCAGCATT
AGAGCTATTAATGGATTTTTTCTCTACTTCTTTATTGTTTATACATCAAAGATGAGAGAT
CAGAAACTCACATTATGCTTAAGGAAGATAACAGGAGCTTCTTGGTCACCAGATTGCTTG
CACAGTTTTGAGAAGCCCTGCTCTATGTATTTACAACTCCCACATGCAGTGCGATAAAAA
TCAACCACAACCAAAGAATTAGTTTCTTTCGACTTTTCAAGAACGCTAAGCAATTCATC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1305, 1381..1519, 1609..1650, 1790..1842, 2068..2226, 2378..2493, 2733..2821, 3028..3129, 3512..3699, 3718..3908, 3958..4006, 4493..4623, 4671..4731, 4956..5068, 5174..5313
1240..1305, 1381..1519, 1609..1650, 1790..1842, 2068..2226, 2378..2493, 2733..2821, 3028..3129, 3512..3699, 3718..3908, 3958..4006, 4493..4623, 4671..4731, 4956..5003
NC_003070.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved