Arabidopsis_thaliana Locus Poly:SnoR111
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR111
Arabidopsis_thaliana
Poly:SnoR111
1
SnoR111, U37
1001..1130, 1201..1290
2290
gaatccggttctagtatcaaattgacaaaccgatattaatcaacaaattggtttaggtt
aaccgggatatataacttttttgtcaaatgtgcgtaggtgataacaaacgggaagtacaa
gagtgtaatgcaccgtgtgatgacccagaaagaaggaaacaggatgtctatcgcgtcgtt
ttacaaccccggaagcgatgctgagatctctccggcaacatctcttgtggataaagactc
aaaatacccaagctttgtgtttgatgactacatgaaactctatgccggactcaagtttca
ggccaaggagccacggttcgaggcgatgaaaaatgctgaagcagctgcggatttgaatcc
ggtggctgtggttgagacattctaaatggatgtgggatcttctacgaaagctaaaagtat
atgatgataaaaagatgtgtggtaatgtcaataaaaggattggggttgatgttagtaaaa
tcaataactaagtgatgaatattatgtgttaagcgtgggagtgagtgactatttatgcaa
taattgtgtgggttctaagttctaactacaatacaatcttaaagatacaataattagaag
aaaaaaaatgacgttatttatgtgattaatatattcaagtttagactataagtttatagc
atatgaagattgtcacacaaaagccattagctctagccatttacatttccatgaattaaa
cctttccaatcaaatagaatgttatataagttgggccgaattacatttcagcccaaaggc
ccaaaggcccaaaagcaattacattgttttggagaacttagggcatcagtcaatatcaaa
ctataaatacctctctgtcgctccgaagcctttttatctcgatttctagggttattaaat
gtcttacttttattagtctcgtctctttgattggatctaagtttctgaattgaaatgttt
ttggatttgattttggaaaaaggaaaacctcgaggttctaaaaaatggggcaagagagag
taacggtgtctctgagtccttgatgaaccggcgagggaaatcaatctggccgagatatcg
tttcagtcgttctttgttttggtttacgatctgattgttgctcgtccacatcttcgtttt
ttatttataaattgatcttcaaaacttatgatttttggcaaacttaatttgatcggaaaa
tgcgaatgatgaatatcaaatttattatttcttcactttgatccgattgggtaattattt
atccttgtggacaatattcagattactgacgcattcacactttttcttataaaatcctaa
ggtttttgtttgatcgtattatttagatctcttattcgtataatatttgtgacttatttt
tagtttgctaatacaattttcttctaatttgattatagaaaatcagttgtccaaatctaa
tctatggaaatgtcatacgtttgtatgatgagaaagaaagcaaaagtaaagttgaaacct
agaatacgcaaattgataccctaaattggcgacttcaatcactaatttcgaatgtacaaa
atgatggagatagtatttaggtgacatggatgtcacttagctaattgacatcttcaaatt
ggtagattgatactacgaaaactaatttgagttctaattaaaacattgggaaatgagaac
cgtggagtgaaatcgtcttacccaaatgagaacattggcataagttattgatactttatc
aaacaaaaagatgtaaagaaattactgaatttttttttaaggataaatcgtgttgaagcc
cagtgaacatgtaaattttgatgggcctcgggtgttttgtgatattctaaaataatttag
ttgggctgtattgaaatatgaaaggcccaactcaaagtcagagataaaaaaaattatacg
acggcccatctaaaaataccttgttggcttgatgcaataatttcgtccctggtttagcaa
tgaaagagaattttatatgctctcaagtcctatactaatgattcaaatgattcattgtca
atatagtacttgttactacaggttatttggttttcactttccgaaaagtctagacggttt
tcacttaagttacaaagcctaagaagaagatgctactgcaacacataacaagtcaaaaac
gttgcgttgagtttttagtaccaagtctactgaatcaaaaacaaaaaaaactctcaaaca
cgcttgaaagcttctgtcgtgatcactgacgaggactggtgacatctttttctctgacat
tatatatttaa
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003070.9
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved