Arabidopsis_thaliana Locus Poly:SnoR9-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR9-2
Arabidopsis_thaliana
Poly:SnoR9-2
5
SnoR9-2, SnoR10-2
1001..1098, 1190..1284
2284
TGTGTAGCTTCGGGGTTAAATCGGTCGCGTGGTTGGTCTGCCACATCGGGAATCTCAGC
CGACGAGAAGCTATTATTCTTGACAGACATTGTAGGGACACACACTAAAGATCTTCTCTC
TAAGAGAAACCCAAAAGGCTCAGCCTTTGTCTCTCTCTCTCTACGTCTCTCTCTATTCTT
CTTCTTCTTCTTGTTCTGCTTCGTTTGTGTTTTTGGTTCGGTGCCGATATAGACGAAATA
GGAGAAAGAAATCGGTCGAAGAAAAAAGTGAGAATTTTGGCCTCTTTTTTTTTTTTGCCA
TTTTTCTTCACTTTAATTAATATATCCTAATTATATTTTTTTCTTCTTAATATCTCCTAA
TTCTATTATTTAAACCGGATTATAAAACTTAAAAAACATAAAATCGACCGCTTTTATAAA
ATTGTATTGCTGTCGAAAAAAAAGAAAAATATTTAAATTTAAACCCACTTGCTCACTTGC
CAAAGCCATGATTAAATTGTAAAATTGAATTTTTGACTAAAAATAATAAAATGACTAACT
ATAACAAAATCAAAGAGCTACGCCGTCTGTGGGGATCGAACCCACGGCCACGTGGTTAAA
AGCCACGCGCTCTACCACTGAGCTAAGACGGCTATTTGTTTATCACTTTCGTTAAACTAT
ATTTAACAAGGTTTATTGTATTAAATTAGAACAATAGACTGGGCCAAAATTGAGTAAAGA
ATGTTTAAGCAAGAAGGCCCAACAAAAGCAAAGGAAGAAAAAGGAAATTTGTAACCAATA
AAAACAGTCCGAACTGGAATTGTACTTGTGTCCAAACAGAGAGTTTAAAGATTTTGTCTT
TTTTAGTCAAACAGATAAATTTAGGGTTTCTTCTCAATCTCTTATAAATAGCTCATCTTC
CGCCGTTCTTTGTACATTCATTCGATTTCTTCTTCTCGTTTCTCAATTTCGCTTCTTTTG
CAATATTCCGTTTTACGAATTTTCTTTGTTTGAAATTGGTCTGAAGAATGTGATGAAAGT
TGTCGATTATGTGTGATGATTCTTTAGATTCAATTGATCGATAAAAACTTCAATTCGCTA
CGTTCTTTCTGATTCTTCATCCCTTTAAAGAAAACAGTTTTCATAAGTTTTGTTTTTAGT
AATTTCAGATTCAGTTTTTCAAGTAATCAAATTGGTGAAAGATAACATCTTGGAGAAATA
TGATGATAATAATCAGTAAATATCTTAGGACACCTTCTGACACAGTTTACTGTGTATGAG
AATGACTTGTTAATCTGATTCTCCATATGTTTCTTCTTTCAAATCTTTATCAAACTGTTT
TACTATCTTCAAGAGCCTTTTATCAGAATCTGATTGAAAGTTAGGAACTTGTAAAAATAT
GTAATCAGAAACAGCATACTGATAATAGGAATCTATGAAACATATATGGATATGTTATGT
TATGTACACATCTCTGTAATATATGAAGAAGTGTACATACATGTAATATACACAAAGAAC
CAAACTCTATGATGAGTCTGTATAAATGTTATACACATCACTCTATAACCACAGAGCTTA
GCTTTTTATAAGCCAACAACAATCTTTTAATCTCTATATATTACAAACAAATTTTTCAAA
ATCTACGAACCAAATAAGACTCTTCTTGATACAACAAGACTTGAATGGTTCTCTGTTTTT
GTCCTCTGATAAAAGACTCCCAGCAAAATCATTCAGATACGTGATTTAGTTTCTGCAGTG
TTTTGCTTTCTGTCTGGTGAAATCTTGGAGCTGCCGGTCGTGTTCTTCCAGCATCTGATC
CACTTTTCTTGGCTGAGCCAGTAATGGACCGGACATGTACATCTTGTTATCCCCTGAATC
ATACTATATCTCCAAAGAGAGAGAGAGAGATAAAGACAATGTAACTGAGAAATGAGGAAA
AAAATAGTCTCTTGAGATGACTTACCCAAGATGGGTCATTTGGGATTTTGGTTTGTCTTT
TACTATTATCCATAGTGTCAGCTCTGTTGAATGTTCTCAATTCCTTCCTTTGCTGATCCA
TCATTTGTTGATCTGACCCAACATAACCGCCTCCTTGTCCTGCTGAGTTAGCCCTATATG
AAGGTATTCTAGGGGCTGCATTGTCCTTCACGTATGTTAACCGACTAAGATTCCGGTTTT
TCATCATCGGACCTGAGTGAGAGACTCTTCCGCTTGTTGGATTGTTGCAGGTCATGTCCT
GCATTTGTCTTTGTGAATTACCCGGAACACAGCTTCTTAGATAAGGATTCTGTATTGGCC
AACAA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003076.8
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved