Arabidopsis_thaliana Locus Poly:SnoR9-1
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR9-1
Arabidopsis_thaliana
Poly:SnoR9-1
1
SnoR9-1, SnoR10-1, SnoR11
1001..1088, 1200..1280, 1346..1455
2455
ATACATAAACTTCACTCCCTCTCGCTGATGTTCAAGCAATCTACAGTTGATAGAAGCCG
GTACCTACAACAAAATCATAAGGCAAATTCAAATAATTTCCAGAATTTGAGAAGAACCAT
CAACACTTGAGTTCCATTAAACATGAGCAAAAGTTAAAGACTTTGGTAAGAAAATAACAT
GTATGATCGGAATCTCTCCAATTGATGACAGCATAAGTGGTTCATAAGGACCGGAATAGT
CAAATTCAGCCCGGCTTAACCCGGGTCTCCCGAATTCAATTGATCTCTCATCGTCTTCAT
CTACTTCTTCTTCGTCGAACTTGATGTTTCTTTTGTGATCATCTTCGTTATGATCAAAAT
CTTCGACTTGGGTTTTTGAGATTTTAGATTCGTGCTTTGAGGGTAAAAAGTAAGAATCAT
CGAGACGCAGAAGCTGCTGCGAGAGCGACGATTTGGGAGGTTTTCTCGACGGTTCCAATT
CTTGTGTGGATGAAACTCGCAACGATGATGATGACGGAAAACTACCACAGGGCTTCAATG
TCTCTTTGAAAGTGTGTAACAACGACATCGCTAATCGATCGCGTTGCGAGAGCAAAGGAA
AAAGACTTGCTTTTTTCGAGAAACTGAAATAAAGTCGTAATATTTAGCAATTTGAAAACT
TACTTGCTGTTATTCTAATTTGAAGAAAATAAGAGGCTAGAAAGGGAAATACATTATACA
TGTGCAGTTTTAATGGGCCAAATACGGATAGAAACGAAGCCCAAACTGTACTTGTGGCAG
TAATAATGGGCCGAGTTCGAATAGCATCCAAGAGAAGCCCAAATATTATTTGTTTCCAAA
CATGCTTTTAGGTTTAGGGTTTCTCGTGCATCTCTTATATATAGCAATCTCCTTCTTGAT
AACGCCGAGAAAAGTCACCATTTGTCGATTCAACCCAATCTTGGTTTTTGGTTTTTCTTT
AATGTTTTGGTGAATTATTTGATTTTCAAGAGGTTTTGTGTAGAATATGATGAAAGTTGT
ATATCGGTGATGGTCTTTTGATTCATATGATCGACAAAAATTTCAACTCGCTACGTTCTT
TCTGATTCTTACAAAAGTTGGATTTTTTATATTTTTGTTTGACGGTTTTGGAGAATTCTC
TCGACGTTTTTGTTTAAATTGGATTTGTATCTTTTGGTATTGGAAAAATAGTAATGCTGG
AGAAATGATGAGAAATCAGATAAATCTTAGGACACCTTCTGACACAGATTCTGTGTATGA
GAATGACATCATATTCTGATCTTCAGTTAAATTTCTTTTTTCGTTTCAAAAACAAGTTTT
TCCGTTCTGTTTGTAATTGAATTTTATGGTTTTGAAGATAGGTTACCTTAATTCTCGGTT
TATTAAGTGGATAATTCAATTTGAATCTACGGATGTTCTTAAGCTGCAAAGAGAGATTGT
GATTCTGAGGCAACCAAATATTACAATTAAACCTTATAATTACAACGGAACAACAATCAA
TTTTAGAAGGAATAATGAATTCAAAGGGATTTTGTATATATGTACACACAGCGAACTCTA
TACGAACAGTAGTGGTTTATGCCTTTAAGCCGATCACATCAACTCAATTTATGAAACCAA
TAGATTATAGTGACAAATCTGACTCAACTGATTCGGCTTTTTAGAACGCTCAATAATTTG
GCTCTTCCAATGATTTCAGCCTTGTGGTGTCTTGAGTGCCTGTCTATTGAATTCCTGAAG
CTGTCTGTCATGTTCTTCAAGCATCTGGTCCACTCTGCTTGGCTGAGCCAACAATGGTCC
TGACATGTAAATCTTGCTATCACTAGGATTATACTGAAACACAACAATGAATGTTAGTAA
AAGAAAACAGCTGCTCTGATACGAGAAAATAAAAAAACAGAGATCATTAACTAACCCAAG
ATGGGTCAATTGGTGCTGTCATATGTCTACTATCCATAGTATCAGCTCTATTGTATGCTC
GCCGATCTCTTCTTCTTTGGTTCGTGACTGGTTGATCTTGCCGTTCTAATAATGTTTTGG
AGGAGACTGAGCCTGATAACATCTTCGGGTTTACTCTAGCTGGAGGGTATCTAGGAAGTG
CATTCTCCTTCACATGCATTGTTGACTTAGCCATGTTCCGGTTGCTCATCAATGGACCTG
AGTGTGAAATTCTCACACCAGTTTGATTGTTTCTGTTGTGCTGCATATTTTGATAATCAG
GAACTGGTCCATGAGGAGTCCTCTCCTCCTTAAACGACTTGAAACTATCGTTCCTACTCC
TCAAATCTTTATATTGTTTCTGCATTTGCCAAAAGAGTGATTTGCTTTACAGTTAGTTAC
CTCCACGGTCATTGTGACCATAAAAGCTAGGACCTTTTACAGTTACTTACCTCCATTGTC
ATTGACAGAGAGTTATTTGCTTTGACCGGTGGTACAAATTTTCTCTCGTGTGATAT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003070.9
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved