Arabidopsis_thaliana Locus poly:U36a-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U36a-2
Arabidopsis_thaliana
poly:U36a-2
1
U36a-2, U38-1, SnoR6-2, SnoR97
1001..1090, 1139..1245, 1265..1381, 1441..1548
2548
TTTGCTGTAATTCTCACAGCCTGGTGACTCAGAAAGACCACGCAGTTCCTCAAGATATG
GAAGCTCTTCGAGGAGAGCAATTCCGTCAAGCTCTCGACCAAGTTCCGCAGGTGGACCAA
GCGATAGTCGATCCTCTAGCCGTCTGGTGACATCAACTGGAGGAGTCGGAACAGTAAGTA
ACCGCGCATCAACAAGCCAGAGAATCCAAGCAGGAAACGAATCCAGGACGTCGTCTTTTT
CGCGTGCTGCTAGAAACACTCGAGAAGATCCATTAAGGAGGAGCTTAGAGCTTCTCACTC
TCAGAAAATGAAACCTGACAAACAAGAAAGTCATTATTATACGTACAATCCAAAAGAACA
AACAGACAGATAATCGTAAGAGAATCTGCGTAAAGATACATTACAATGTTCCATATATAC
TTTATATAGTTTATTTTGTATATGTAAAACAGTTATAGAAGCCGAAATTTCTTCATCATT
GGCAGATGACGCAGACTCAAAGTACACTTTTGTTGGTAAACAAATTACTACTTCGATCTA
TCTGTAATGAAAAAAAATATAACAAATTGTTTACTGGACGGTTATTATTTAACCGCAAAA
AACTAACGGGGGCAATTTCGACTTTTCGGGATAGAGATTAAAGGCTAGGGTTTTGACCAG
CCGCGTGCTATTTAATCATCTTCTTCTTTCCGTTGTTTCTTACAATTATCGATCTTTAGA
TTAGGGTTCTTTTTAGACGTGTAGTGTTTTATACTTTTTATATATATATATATCTAGTTA
TGGTTCGCAGGAGCCTCCCGGGCTAGTCTGATAACTAAGGTACTTGAGGAACTAAGCCCC
AAAGCTCCTGCTAGATTATTTTTGCCGTTTGTGTTGCAGATTTGCCTTATTCCTTAGGCT
TTTCTGTGTCAAAAAAGCGGCTATATCTCTCTTTTCTGTGTATGTTTTGCTTTGAGCTGT
GTTTGTTGATGGTATCGATTTGGTATCAACGTTTGTTTATGTGGCAATGATTATAAACTT
ACCCGCGCTTCTGAGATTATTCAATGAAGCAGATACGGTAAATACATGGTTGAATTTCTT
AATATGAGCCAAAGTTTTGTTTTTTTTTATATGGGTTTCTGTGTTTTGATTGGCTGGGAT
GATGAATTGTAACAGCTTGATACGCCAGTTCTGCTTCAGATAATTCTTGATCGAAAAAGC
TGTATTCTTATCCGAGCCTTTCATTGCTATTTTGTCTTTCTTCTGAGTTATTATTTCTTG
GGAATGTCGATGAGGATCTAATCCAATCTTACGAGGTGCAGTGGAGCTGAGACCTTGTTT
TACAGGGAGAACCCCTTGGCAGAAGCTGCAATTTCTTTGACTTCAATGGATTTTACTGAG
ACTTTCTCATTCATTTATCGTTTTTATTGAAATCTATTTGAGTTTAAACTATACACTTGC
ACTTGTATCTTAGTGCTTGTAGTCTGAAAAAACTCATAAATTCTCAGTGTTCTCATCAGC
TTCCGTCTCCTTAACCATGAGACTTGAGTTAAACAAGATCACTACATTATTCTCTTTCAA
TTTCACATTATCTTTTTGTTTTCTTGTTTTGAGTTTATATTTCGGACTAAAGAGTATGTT
TTGCCCGTATTTATGAGGTTGGATATGGATATTAAACAACAAGTCTATCCGTTCCAACAA
CGCTTTTCATAGAGTCATTTCGTTGCTACAAGTTATTGGATGAGAAAGGGGCTGCTACGT
TGCGAATTTCTTGATCCCCTGTTGTAGAATTGAGTCAAACACATCCATTTTCTTCTTCTC
TAGTGCTATTCCAATCTCAACTCCATTGCTGCCGTCTCTGGACTCTGAGAATGCGATAGA
ACCACCTGTTTCTATGTGCACGATCTCCATTTTGCAGGGCTTTCCTAATCCAAAATCCAT
GTCATACAGTCCCAATTTCGGAGCTCCTGCAATTGAGGTTGGATAATGGGACATGACCCA
TTTACGTACTCCTTGTCCCCATCTTGGTGCTGTCTTCAACAGATCGCTTGATAACATATC
TTTGATTCTCGCTGTGATTGCATCTGAAGCCGCCAAAACGCATTTTTCTCCTAGCAAATC
GTGTTTCTTGACTGATACGATACCAGGAGCCATACAGTTGCCAAAGTATGTTTGTGGTAT
TGGTTGTGTGTACTTGAGGCGATTCCTGCAATCCACATTGATCATCAAGTGAAATACTTC
ATCCTTGTCTTCCTCGTTGGCCTTTGTTTCACTGTCTTGTACAAGTGTCTTGATCAAGCT
TACCCAAATGAAAGCTAGAGTCACCACGAAGGTAGAAACAGGAGATTGATTCTCAGACTG
CTCTGTAACCCAACTTTTTAGATTATCTATCTGCTTCCGGCTCAATGTAAAAGTGGCTCT
GACCATGTTCTCAGGCGTAACATGTGAACTGTGTTTTGCAGAGTTTTGGCTCCAAAACCG
CTCCAAATGTCCTGCGCCTACCTCGCCTGGGTCCTTGATCATGTTTCTGCAGCTGTGAAT
AGGCAGAGAGGGTAGAAGAACCGTGGCGG
  Untranslated Region
  Coding Sequence
  snoRNA
CP002684
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved