Arabidopsis_thaliana Locus poly:U36a-1
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U36a-1
Arabidopsis_thaliana
poly:U36a-1
1
U36a-1, U38-2, SnoR6-1, SnoR97-2
1001..1090, 1140..1246, 1266..1382, 1441..1549
2550
ttgcgtgcaagcaaggatcattactcgtgtttggtggatgtcttaagcagagtagggag
atttgaagaagcttataaagtgattcaagctatgcctgagaagccaacggctaagacatg
gggggctttgcttggagcttgtaggaactacggtgagattgagctagcagagattgctgc
aagagaattgttgatggtagagccagagaatcccgcgaattatgtgttgttggggaagat
atatatgagtgttggaagacaagaagaggcagagagacttagattgaagatgaaggagag
tggagtgaaggtttcaccaggtagtagttggtgtttgttcaaagattgacatattaccat
gctcatgaaatttttgtaagctcatacacaattttcgaaatcaaggttgtataattatac
ttaatactattcttaaattataagaaaataatatgcaaaaatacctgcaaaagaagtttg
taatttgtgatcttgtaacaagttaaggcataacattcgcatatgaatttgaattttgta
aggccgggcatatttgagccatcacaaacctaacgggggccggttaacgtctaaccgcaa
caataaactaacgggggcaatttcgacttcttggcatagagagaatcaggctagggtttt
gaccagccgcgtgctatttaagtcatcttcttccttgctttgtgtcgtacaattagaatc
gatctttagaatttgggttcttcgtcaatcgctttagggtttgattatatatatatagtg
tggttagcaggagcctcccgggctaatctgataactaaggtacttgaagaagtaagcccc
aaagctcctgctagattatttttagcgtttgtgttgcagatttgccgtattccttaggct
tttctgtgtcaaaaaagcgtctatatctctcttttctatgtatgttttgctttgagctgt
gtttgttgatggaatcgagttggtatcaacgtttgtttatgtggcaatgattataaactt
acccgcgcttctgagattattcaatgaagtagatacggtaaatacatggttgaatttctt
aatatgagccaaagttttgttttttttttatatgggtttctgtgttttgattggctggga
tgatgaattgtaacagcttgatacgccagttctgcttcagataattcttgatcgaaaaag
ctgtattcttatccgagcctttcattgctattttgtctttcttctgagttattatttctt
gggaatgtcgatgaggatctaatccaatcttacgaggtgcagtggagctgagaccctgtt
ttacagggagaaccccttggcagaagctgtaatttctttgacttcaatggattttactga
gactttctcattcatttatcgcttttattgaaatctatttgagtttaaactatacacttg
cacttgttttcttagtgcttgtagtctgaaaaaactcataaattaccagtgttctcatca
gctttggtctccttaaccatgagacttgagttaaacaagatcactacattattctctttc
aattttatattatctttttgttttcttgttttgagtttctgttttcggacaaagagtatg
ttttgcccgtatttatgaggttggatatggatattaaacaatatgaaaagcgttggtgga
acggatagacttgttatgattcgtgggactgaacaacttcggttttgtgttgaatcattt
cgttgctacaagttattggatgagaaaggggctgctacgttgcgaatttcttgatcccct
tttgtagaagtgagtcaaacacatccattttcttcttctctagtgctattccaatctcaa
ctccattgctgccgtctctggactctgagaatgcgatagaaccacctgtttctatgtgca
ctatctccattttgcagggctttcctaatccaaaatccatgtcatacagtcccaatttcg
gagctcctgcaattgaggttggataatgggacatgacccatttacgtactccttgtcccc
atcttggtgctgtcttcaacagatcgcttgataacatatctttgattctcgctgtgattg
catctgaagcagccatgacgcatttttctcctagcaaatcgtgttcttgactgatacgat
accaggagccatacagttgccaaagtatgtttgtggtattggttgtgtgtacttgagacg
attcctgcaatccacgttgatcatcaagtgaaagacttcgtccttggcctctgtttcact
gtcttgaacaagtgtcttaatcaagcttacccaaatgaaagctagagtcaccacgaaggt
agaaacaggagattgattctcagactgctctgtaacccaactcttgagattgtctatctg
cttccggctcaatgtaaaagtggctctgaccatgttctcaggcgtaacatgtgaactgtg
ttttgcagagttttggctccaaaaccgctccaaatgtcctgcggctacctctcctgggtc
cttgattatgtttctgcagctgtgaataggc
  Untranslated Region
  Coding Sequence
  snoRNA
CP002684
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved