|
|
| Xenopus_tropicalis SNORD93 | |
| sequence |
TAGCCAATGATGAGGAATGTACTCCTGAATAGAGATGTTACTTCTTTATTTGATGTCTC
AAAGGATTTACCTGAGGCTA
Box motif
Complementary to target RNA |
| length | 79 |
| organism | Xenopus_tropicalis |
| snoRNA name | SNORD93 |
| alias | |
| chromosome ⁄ contig | scaffold_56 |
| locus ⁄ host gene | Poly:3:SNORD93 |
| organization | Poly |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |