|
|
| Triticum_dicoccoides SNORD96 | |
| sequence |
TGTCCGGTGATGAAAAACCTGTTAATCATACCATCTTTCGGGACTGATTGGTCACAGTG
TGCCCATGCTGTCATTCGGCAGTTCTGAGGAAA
Box motif
Complementary to target RNA |
| length | 92 |
| organism | Triticum_dicoccoides |
| snoRNA name | SNORD96 |
| alias | |
| chromosome ⁄ contig | 6B |
| locus ⁄ host gene | Mono:30:SNORD96 |
| organization | Mono |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 5.8S:G74,28S:G807 |
| accession no | LSYQ02000012.1 |
| orthologs | list |
| multiple alignment | |