|
|
| Triticum_dicoccoides snoR12 | |
| sequence |
ATCTGGGTGATGAAGAAAATCGTTCGGATTCCCACTGATTTTCATGATTATTACAACCA
GATACTTCTGACGGAT
Box motif
Complementary to target RNA |
| length | 75 |
| organism | Triticum_dicoccoides |
| snoRNA name | snoR12 |
| alias | |
| chromosome ⁄ contig | 5B |
| locus ⁄ host gene | Poly:12:SNORD24 |
| organization | Poly |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 28S:A938 |
| accession no | LSYQ02000010.1 |
| orthologs | list |
| multiple alignment | |