|
|
| Triticum_dicoccoides snoZ101 | |
| sequence |
TTGATGCAAATGTGGAAACACGAGTTTATGGGTAATTTGTGTCTGAGGCATTTCTTTGA
TGTCACTCTTTCACCTTGGAGATCTGATGCATCCT
Box motif
Complementary to target RNA |
| length | 94 |
| organism | Triticum_dicoccoides |
| snoRNA name | snoZ101 |
| alias | |
| chromosome ⁄ contig | 4A |
| locus ⁄ host gene | Poly:48:SNORD25 |
| organization | Poly |
| target RNA | |
| modification type | |
| modification site | |
| accession no | LSYQ02000007.1 |
| orthologs | list |
| multiple alignment | |