|
|
| Triticum_dicoccoides snoU36a | |
| sequence |
TGGCAGTGATTTGAATCTTACCCGCGCTTCTGATTAATTCATGAAGTACAAGGGAAAAC
ATGGTTGAATTTCTTAATATGAGCCA
Box motif
Complementary to target RNA |
| length | 85 |
| organism | Triticum_dicoccoides |
| snoRNA name | snoU36a |
| alias | |
| chromosome ⁄ contig | 4B |
| locus ⁄ host gene | Poly45:snoR16 |
| organization | Poly |
| target RNA | |
| modification type | |
| modification site | |
| accession no | LSYQ02000008.1 |
| orthologs | list |
| multiple alignment | |