|
|
| Triticum_aestivum snoR12 | |
| sequence |
TTCTGCATGATGAAGAAAATCGTTCGGATTCCCACTGATACTTCATGATTATCACAACC
AGCTACTTCTTACAGAC
Box motif
Complementary to target RNA |
| length | 76 |
| organism | Triticum_aestivum |
| snoRNA name | snoR12 |
| alias | |
| chromosome ⁄ contig | 1B |
| locus ⁄ host gene | Poly61:SNORD24 |
| organization | Poly |
| target RNA | 28S rRNA |
| modification type | |
| modification site | 28S:A939 |
| accession no | JAGHKL010000002.1 |
| orthologs | list |
| multiple alignment | |