|
|
| Triticum_aestivum SNORD34 | |
| sequence |
TCTTACCTATGATGAGTTGCGAACTGTATTGCCTACATTGTTTGAACAATCTGTGAGAA
CGTATGCAACGTCTGAGGATGA
Box motif
Complementary to target RNA |
| length | 81 |
| organism | Triticum_aestivum |
| snoRNA name | SNORD34 |
| alias | |
| chromosome ⁄ contig | 6A |
| locus ⁄ host gene | LOC123132405 |
| organization | Intronic |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 28S:U1888 |
| accession no | JAGHKL010000016.1 |
| orthologs | list |
| multiple alignment | |