|
|
| Triticum_aestivum snoR26 | |
| sequence |
AGAGCATCCGTGATGTTACATCCACTTAACTCATCCTTGCACTTTGAGTTGCGACAGTG
AAGAAAAACATTGGGGAATATGTAGTCTGAGATGCTC
Box motif
Complementary to target RNA |
| length | 96 |
| organism | Triticum_aestivum |
| snoRNA name | snoR26 |
| alias | |
| chromosome ⁄ contig | 1D |
| locus ⁄ host gene | Poly56:snoR77Y |
| organization | Poly |
| target RNA | 18S rRNA |
| modification type | |
| modification site | 18S:C60 |
| accession no | JAGHKL010000003.1 |
| orthologs | list |
| multiple alignment | |