|
|
| Triticum_aestivum snoZ223 | |
| sequence |
CCATGGCTGTGATGATAAACACTTTCAACAAACATGCCAGTTCTGCTTCTGAAAATTCA
TGACTGAAAAACCTGTCATACAAGATCTGTTT
Box motif
Complementary to target RNA |
| length | 91 |
| organism | Triticum_aestivum |
| snoRNA name | snoZ223 |
| alias | |
| chromosome ⁄ contig | 5A |
| locus ⁄ host gene | Poly12:snoU36a |
| organization | Poly |
| target RNA | 28S rRNA |
| modification type | |
| modification site | 28S:A1136 |
| accession no | JAGHKL010000013.1 |
| orthologs | list |
| multiple alignment | |