|
|
| Triticum_aestivum snoZ199 | |
| sequence |
GGGTCAAGTGATGAGGAATAAACCATCAACAATATGATGGAGCTATGCTCCTCTGATTC
TTAGTATTTAAGTCTCTGATGGTACC
Box motif
Complementary to target RNA |
| length | 85 |
| organism | Triticum_aestivum |
| snoRNA name | snoZ199 |
| alias | |
| chromosome ⁄ contig | 7D |
| locus ⁄ host gene | Poly62:snoZ199 |
| organization | Poly |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 28S:U3294 |
| accession no | JAGHKL010000021.1 |
| orthologs | list |
| multiple alignment | |