|
|
| Triticum_aestivum snoZ101 | |
| sequence |
TTGATGCAGGTGAGAAGACACAAGTTTTATGTGTAATTTGCGTCTGAGGTGTCTCTGTG
ATGTCACACCCTTTTAACGTTGGATATCTGATGCATCCT
Box motif
Complementary to target RNA |
| length | 98 |
| organism | Triticum_aestivum |
| snoRNA name | snoZ101 |
| alias | |
| chromosome ⁄ contig | 1B |
| locus ⁄ host gene | Poly49:snoZ101 |
| organization | Poly |
| target RNA | |
| modification type | |
| modification site | |
| accession no | JAGHKL010000002.1 |
| orthologs | list |
| multiple alignment | |