|
|
| Triticum_aestivum snoR8a | |
| sequence |
CATGGTGCAGTGATTATAAAACATTCCTCGTACTGATGGGAGTTCCCTGTGAATGACTC
CTATACACCCATAGAATCTGAGCACT
Box motif
Complementary to target RNA |
| length | 85 |
| organism | Triticum_aestivum |
| snoRNA name | snoR8a |
| alias | |
| chromosome ⁄ contig | 7A |
| locus ⁄ host gene | LOC123148865 |
| organization | Intronic |
| target RNA | 18S rRNA |
| modification type | |
| modification site | 18S:A1582,18S:U1265 |
| accession no | JAGHKL010000019.1 |
| orthologs | list |
| multiple alignment | |