|
|
| Triticum_aestivum snoR77Y | |
| sequence |
GAGCCTATGATGATTAGCTTTATGTTGGAATTACCGTCAGATTCCAAATGATGATATTT
TTGCGGCTTTCTGAGGCTTTAA
Box motif
Complementary to target RNA |
| length | 81 |
| organism | Triticum_aestivum |
| snoRNA name | snoR77Y |
| alias | |
| chromosome ⁄ contig | 7B |
| locus ⁄ host gene | Poly28:snoR83 |
| organization | Poly |
| target RNA | 18S rRNA |
| modification type | C/D |
| modification site | 18S:U582 |
| accession no | JAGHKL010000020.1 |
| orthologs | list |
| multiple alignment | |