snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae U24
sequence
TCAAATGATGTAATAACATATTTGCTACTTCAGATGGAACTTTGAGTTCCGAATGAGAC
ATACCAATTATCACCAAGATCTCTGATGAA
  Box motif
  Complementary to target RNA
length 89
organism Saccharomyces_cerevisiae
snoRNA name U24
alias snR24
chromosome ⁄ contig XIII
locus ⁄ host gene ASC1
organization Intronic
target RNA 25S rRNA
modification type C/D
modification site 25S:C1437,25S:A1449,25S:G1450
accession no Z48760,BK006946
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved