|
|
| Rattus_norvegicus SNORD113 | |
| sequence |
TGGATCATTGATGACCAGAAAAAAATCATCTCGGAGTCCTCTGAGACATCCATGATGAC
CACAACATTGGGAGTCTGAGGTCCAC
Box motif
Complementary to target RNA |
| length | 85 |
| organism | Rattus_norvegicus |
| snoRNA name | SNORD113 |
| alias | |
| chromosome ⁄ contig | 6 |
| locus ⁄ host gene | Poly:0:SNORD113 |
| organization | Poly |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |