|
|
| Pongo_pygmaeus SNORA31 | |
| sequence |
CTGCATCCACTGATAGACCTTGAACAATTTACTGTTGTTCTTTTGGTTTGCACTAGGAT
GCAAAAGAAAGAAATCCCTGCGCTTTCTGTCTGTCTTTGTGGCGGCCCAGATTGAATTGG GGAATACATCT
Box motif
Complementary to target RNA |
| length | 130 |
| organism | Pongo_pygmaeus |
| snoRNA name | SNORA31 |
| alias | |
| chromosome ⁄ contig | 13 |
| locus ⁄ host gene | TPT1 |
| organization | Intronic |
| target RNA | |
| modification type | H/ACA |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |