|
|
| Pongo_pygmaeus SNORA11 | |
| sequence |
GGGGTGCGCTCAGAGCAGAGGGCCTTAAGAATGGCTCCTCTGTTTACAACACACCCAAT
AGGAATCTGGGCTTACTCCTCACAGGTGGCATGATACTTTGGCCTTCCTGTGACATCATG CCCTATACAT
Box motif
Complementary to target RNA |
| length | 129 |
| organism | Pongo_pygmaeus |
| snoRNA name | SNORA11 |
| alias | |
| chromosome ⁄ contig | X |
| locus ⁄ host gene | TRO |
| organization | Intronic |
| target RNA | |
| modification type | H/ACA |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |