|
|
| Pongo_pygmaeus SNORD18 | |
| sequence |
CTATTATGATGAGATTACGCTCTGTGGTCCGTGTTTCTGAAACACATGATTTTGTGGAA
GTTCTCATTTG
Box motif
Complementary to target RNA |
| length | 70 |
| organism | Pongo_pygmaeus |
| snoRNA name | SNORD18 |
| alias | |
| chromosome ⁄ contig | 15 |
| locus ⁄ host gene | Mono:169:SNORD18 |
| organization | Mono |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |