|
|
| Physcomitrium_patens snosnR60_Z15 | |
| sequence |
tgacggcgggtgatgcgtatgcatagttcaaatgagcctcactggggctttgattaatt
acagaaattagtctttcgctcctatctgacgcctaaa
Box motif
Complementary to target RNA |
| length | 96 |
| organism | Physcomitrium_patens |
| snoRNA name | snosnR60_Z15 |
| alias | |
| chromosome ⁄ contig | 27 |
| locus ⁄ host gene | Poly19:snoR83 |
| organization | Poly |
| target RNA | |
| modification type | |
| modification site | |
| accession no | ABEU02000027.1 |
| orthologs | list |
| multiple alignment | |