|
|
| Pan_troglodytes SNORA71 | |
| sequence |
TTCTGCATCCGAAAGTGATCTAGGCTGCCTGTGCCTAGGTCATTGATAGTGCAGGGAGA
GGAACGCTGAAAGAGGTTGTCCCCGTGTTTGGAGGGTCCACCCTATCCCATCCAAACCCT GAAGCTTTCACACA
Box motif
Complementary to target RNA |
| length | 133 |
| organism | Pan_troglodytes |
| snoRNA name | SNORA71 |
| alias | |
| chromosome ⁄ contig | 20 |
| locus ⁄ host gene | ENSPTRG00000024373 |
| organization | Intronic |
| target RNA | |
| modification type | H/ACA |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |