|
|
| Pan_troglodytes SNORD93 | |
| sequence |
TGGCCAAGGATGAGAACTCTAATCTGATTTTATGTGCTTCTGCTGTGATGGATTAAAGG
ATTTACCTGAGGCCA
Box motif
Complementary to target RNA |
| length | 74 |
| organism | Pan_troglodytes |
| snoRNA name | SNORD93 |
| alias | |
| chromosome ⁄ contig | 7 |
| locus ⁄ host gene | Mono:71:SNORD93 |
| organization | Mono |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |