|
|
| Pan_troglodytes SNORA32 | |
| sequence |
TGGTAATTACCAAGATTTTTAGAATGCAGTTTCTCATTTGCCATGGACATGACCACAAA
ATAATTTCCCACTAGATTTTTTTATCTGTTACCTTGCTAGCAAGCCGTCTATTGGGAACA TTT
Box motif
Complementary to target RNA |
| length | 122 |
| organism | Pan_troglodytes |
| snoRNA name | SNORA32 |
| alias | |
| chromosome ⁄ contig | 8 |
| locus ⁄ host gene | Mono:118:SNORA32 |
| organization | Mono |
| target RNA | |
| modification type | H/ACA |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |