|
|
| Otolemur_garnettii SNORD113 | |
| sequence |
TGGACCAATGATGACAAGTGGTGGCATTTGAGTCATGGATGATGAATAATATGTGTCTG
AAACTCTGAGGTCCAA
Box motif
Complementary to target RNA |
| length | 75 |
| organism | Otolemur_garnettii |
| snoRNA name | SNORD113 |
| alias | |
| chromosome ⁄ contig | scaffold_116158 |
| locus ⁄ host gene | Poly:5:SNORD113 |
| organization | Poly |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |