|
|
| Oryzias_latipes SNORD58 | |
| sequence |
CTGCAGTGATGACCTCTTAGGACACCTTTGGATTCTCCATGAAAACAACTTCTGACCTG
AGCAGC
Box motif
Complementary to target RNA |
| length | 65 |
| organism | Oryzias_latipes |
| snoRNA name | SNORD58 |
| alias | |
| chromosome ⁄ contig | scaffold2259 |
| locus ⁄ host gene | RPL17 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |