|
|
| Oryzias_latipes SNORD31 | |
| sequence |
CAGACGTGATGAGTTCCTATTACCGCCCCAGTCTGAGAATTCATGACTGATTGGTTAAC
CCCTCTGATCTTTG
Box motif
Complementary to target RNA |
| length | 73 |
| organism | Oryzias_latipes |
| snoRNA name | SNORD31 |
| alias | |
| chromosome ⁄ contig | 18 |
| locus ⁄ host gene | Poly:6:SNORD31 |
| organization | Poly |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |