|
|
| Oryctolagus_cuniculus SNORD113 | |
| sequence |
TGGACCAATGATGAGTGACATAAGGATTATGATTAAACCAAGTCTATGCACCTGAGGTC
CAA
Box motif
Complementary to target RNA |
| length | 62 |
| organism | Oryctolagus_cuniculus |
| snoRNA name | SNORD113 |
| alias | |
| chromosome ⁄ contig | GeneScaffold_56 |
| locus ⁄ host gene | Mono:224:SNORD113 |
| organization | Mono |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |