|
|
| Oryctolagus_cuniculus SNORD115 | |
| sequence |
GGTTGCCGATGGTGAGACCTCATACTGTGTCAGAGAGAGATGATGACTTAAAAATCATG
CTCAATAGGATTACGCTGAGGCCC
Box motif
Complementary to target RNA |
| length | 83 |
| organism | Oryctolagus_cuniculus |
| snoRNA name | SNORD115 |
| alias | |
| chromosome ⁄ contig | scaffold_185821 |
| locus ⁄ host gene | Poly:16:SNORD115 |
| organization | Poly |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |