|
|
| Oryctolagus_cuniculus snoU2-30 | |
| sequence |
GAGCAATGATGAAAAGGTTTTACAACTGACCTTTATAACTATGAGGTTTTCTACACTTG
ACCTGAGCTCA
Box motif
Complementary to target RNA |
| length | 70 |
| organism | Oryctolagus_cuniculus |
| snoRNA name | snoU2-30 |
| alias | |
| chromosome ⁄ contig | scaffold_165032 |
| locus ⁄ host gene | Poly:24:snoU2-30 |
| organization | Poly |
| target RNA | |
| modification type | unknown |
| modification site | |
| accession no | |
| orthologs | |
| multiple alignment | |