|
|
| Ornithorhynchus_anatinus SNORD78 | |
| sequence |
TTACAATGATGTCTTCAAATGTCTGACCTGAAAGTCTATGTAGACAAGCTTGCTTCTGA
AAGA
Box motif
Complementary to target RNA |
| length | 63 |
| organism | Ornithorhynchus_anatinus |
| snoRNA name | SNORD78 |
| alias | |
| chromosome ⁄ contig | Ultra341 |
| locus ⁄ host gene | ENSOANG00000020492 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |