|
|
| Ornithorhynchus_anatinus SNORD65 | |
| sequence |
TGATGATGAAAGTTGTCAAAACAGCTGGAGTCACCAGCAGGTGGCGCTGTGCTGGACCG
GTTGTTTTCTGAAG
Box motif
Complementary to target RNA |
| length | 73 |
| organism | Ornithorhynchus_anatinus |
| snoRNA name | SNORD65 |
| alias | |
| chromosome ⁄ contig | Contig7083 |
| locus ⁄ host gene | Mono:SNORD65 |
| organization | Mono |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |