|
|
| Ornithorhynchus_anatinus SNORA14 | |
| sequence |
CCGCGGGCTTCGACCCTCTCGGTAGCGTCGCCGGGAGCTTCGGAGATGCGAGCGAACGC
GGCGGGAGACTGCGGGGCGATCCGGGGCGCCGGGCCCATCTCCTGGGGCCCGGCGTTCTT TCACTAAAACTGAAACGGCTC
Box motif
Complementary to target RNA |
| length | 140 |
| organism | Ornithorhynchus_anatinus |
| snoRNA name | SNORA14 |
| alias | |
| chromosome ⁄ contig | Contig27027 |
| locus ⁄ host gene | ENSOANG00000015418 |
| organization | Intronic |
| target RNA | |
| modification type | H/ACA |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |