|
|
| Ornithorhynchus_anatinus SNORA7 | |
| sequence |
CCCCTCTCAGGGTCACACCTGGAGAGTTTCCAGCACTCTACCAGTCTTGACTACAGGAG
GGAGAGTCAAGCAGAGTCCTACCCATTCCATTCCTAGCTTGGCCAGTGGCTAGCAAGTGG ACGGCAATCTTATACAAGT
Box motif
Complementary to target RNA |
| length | 138 |
| organism | Ornithorhynchus_anatinus |
| snoRNA name | SNORA7 |
| alias | |
| chromosome ⁄ contig | Contig164296 |
| locus ⁄ host gene | Mono:SNORA7 |
| organization | Mono |
| target RNA | |
| modification type | H/ACA |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |