|
|
| Myotis_lucifugus SNORD19B | |
| sequence |
GGATGGCTGAAATATGATGAGTATACAAAATCTTGATTTAAATAATGAGAACATATAAG
ATCCAACTCTGATTTCATCCAGAG
Box motif
Complementary to target RNA |
| length | 83 |
| organism | Myotis_lucifugus |
| snoRNA name | SNORD19B |
| alias | |
| chromosome ⁄ contig | scaffold_83 |
| locus ⁄ host gene | GNL3 |
| organization | Intronic |
| target RNA | 18S rRNA |
| modification type | C/D |
| modification site | 18S:G684 |
| accession no | AAPE02022331.1 |
| orthologs | list |
| multiple alignment | |