|
|
| Myotis_lucifugus SNORD113 | |
| sequence |
CGGACCAATGGTGATGACTGGTGGAGTATGAGTCATGGATGATGAATACTATGTGCCTG
TTTAT
Box motif
Complementary to target RNA |
| length | 64 |
| organism | Myotis_lucifugus |
| snoRNA name | SNORD113 |
| alias | |
| chromosome ⁄ contig | scaffold_479 |
| locus ⁄ host gene | Poly:15:SNORD113 |
| organization | Poly |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | AAPE02047295.1 |
| orthologs | list |
| multiple alignment | |