|
|
| Myotis_lucifugus SNORD60 | |
| sequence |
AGCCTATGATGAGTTGCTTTAATTTCTGACACCTCGTATGAAAACTGCACGTGCAGTCT
GATTATTTTGCAAGACTGAGGCTT
Box motif
Complementary to target RNA |
| length | 83 |
| organism | Myotis_lucifugus |
| snoRNA name | SNORD60 |
| alias | |
| chromosome ⁄ contig | scaffold_332 |
| locus ⁄ host gene | Mono:305:SNORD60 |
| organization | Mono |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 28S:G3690 |
| accession no | AAPE02041713.1 |
| orthologs | list |
| multiple alignment | |