|
|
| Myotis_lucifugus SNORD77 | |
| sequence |
ATACTGTGATGCTTGCATAGTTCAGCAGATTGAATTCTGAAGAAATGTACCACTTGTCT
GATGTATCT
Box motif
Complementary to target RNA |
| length | 68 |
| organism | Myotis_lucifugus |
| snoRNA name | SNORD77 |
| alias | |
| chromosome ⁄ contig | scaffold_54 |
| locus ⁄ host gene | Poly:27:SNORD81 |
| organization | Poly |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 28S:A1420 |
| accession no | AAPE02018271.1 |
| orthologs | list |
| multiple alignment | |