|
|
| Mus_musculus SNORD12 | |
| sequence |
GCTGGTGAACTGATGATATCATTTCTTTCCCCGTCAGATCGACCCTGTTGATCTCAAAT
ACTAATTGCCAGTTTTGTCTGATGCATCAGC
Box motif
Complementary to target RNA |
| length | 90 |
| organism | Mus_musculus |
| snoRNA name | SNORD12 |
| alias | |
| chromosome ⁄ contig | 2 |
| locus ⁄ host gene | 1500012F01Rik |
| organization | Intronic |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 28S:G3555 |
| accession no | |
| orthologs | list |
| multiple alignment | |