|
|
| Mus_musculus SNORD85 | |
| sequence |
GGCAGGGATGATACATACTTGCCCTCACTTAGACCAGAGGTCGATGATGAGAGCTTTGT
TCTGAGCCAG
Box motif
Complementary to target RNA |
| length | 69 |
| organism | Mus_musculus |
| snoRNA name | SNORD85 |
| alias | |
| chromosome ⁄ contig | 4 |
| locus ⁄ host gene | Pum1 |
| organization | Intronic |
| target RNA | 18S rRNA |
| modification type | C/D |
| modification site | 18S:G602 |
| accession no | |
| orthologs | list |
| multiple alignment | |