|
|
| Mus_musculus SNORD42 | |
| sequence |
GTGCATATGATGGAAAAAATCTGAAGTCTCCTGAGACCTGTGATGTCTTCAAAGGAACC
ACTGATGCAC
Box motif
Complementary to target RNA |
| length | 69 |
| organism | Mus_musculus |
| snoRNA name | SNORD42 |
| alias | |
| chromosome ⁄ contig | 11 |
| locus ⁄ host gene | Rpl23a |
| organization | Intronic |
| target RNA | 18S rRNA |
| modification type | C/D |
| modification site | 18S:U116 |
| accession no | |
| orthologs | list |
| multiple alignment | |